Recombinant Expression and Purification of Latent Membrane Protein 1 of Epstein-Barr Virus: Potential Insights Into Oligomerization and Lipid Raft Association

February 26, 2016

Jason McAloon
Department Of Biology 
Lake Forest College
Lake Forest, IL 60045

Abstract

The presence of Epstein-Barr virus (EBV) and the expression of viral proteins in certain tumor cells suggest that the virus (EBV) contributes to the development of malignancies. The viral protein, latent membrane protein 1 (LMP1), functions as a tumor necrosis factor receptor analog, and is expressed in EBV associated cancers. Insufficient information is known about LMP1’s oligomerization and lipid raft association to induce cellular signaling. Understanding the functioning of LMP1’s activation in tumor cells is imperative for designing an approach to interfere with LMP1 signaling. To further study this protein, recombinant LMP1 was expressed from baculovirus-infected Sf21 cells. Recombinant LMP1 fractionated in membrane fractions, suggesting that it is folded correctly, and was successfully purified using a poly-histidine tag.

Upon large-scale purification, LMP1 will be crystallized and analyzed by x-ray diffraction to determine its structure relationships. LMP1 structural information can be used to determine the oligomerization of LMP1 and give insights into how LMP1 is associated with lipid rafts.Understanding LMP1 complex formation will aid in the discovery of novel therapeutic strategies to block EBV-associated cancer growth through targeting LMP1.

Introduction

The Epstein-Barr virus (EBV) is a human gamma herpesvirus associated with tumor development. EBV is the cause of infectious mononucleosis, and has also been found to contribute to carcinomas and lymphomas related to immunodeficiencies. New investigations have also found EBV to increase the risk of developing other diseases such as multiple sclerosis (Levin et al., 2011). EBV contributes to tumor cell growth and survival through infection involving a group of latent proteins. The viral signaling of a particular latent protein, latent membrane protein 1 (LMP1), is required to establish viral infection and immortalize cells in some EBV-related cancers and diseases. The work of this research is to understand LMP1’s structural and functional roles in relation to the development of EBV associated cancers and diseases.

History of Cancer Viruses

The counterculture of the late 1950’s and early 1960’s represented a time of change, whether it is civil rights, music, fashion, or art. Science was no different. At the time, viruses were known to cause diseases such as influenza, poliomyelitis, and measles, but conventional thinking made it difficult to believe that a viral particle could cause certain types of human cancers (Bertrand, 2004). Everything changed when medical researcher Anthony Epstein discovered the first human tumor virus, which opened the scientific community’s eyes to the connection between cancer and viruses.

Denis Burkitt first reported on the presence of malignant tumors in the jaws and abdomen of children while working at Mulago Hospital in Uganda (Burkitt, 1958). Although Burkitt routinely saw such cases, the cause of the tumors (renamed Burkitt lymphoma) remained unknown throughout his time in Uganda. Progress towards discovery wasn’t made until Anthony Epstein gained an interest in Burkitt’s lymphoma after working on a cancer-causing virus in chickens (Epstein, 2012). He considered the possible involvement of a cancer-causing virus in humans, and shifted his work from chickens to humans. After Epstein teamed up with Yvonne Barr and Bert Achong, advances in technology allowed them to view Burkitt lymphoma cells with an electron microscope. The Burkitt lymphoma cells displayed lymphoblasts filled with a herpes-like virus (Epstein, Henle, Achong, & Barr, 1964). This discovery foreshowed complex changes in ways of thinking about the causes of cancer. Cancer-triggering viruses precipitously became a hot topic of investigation throughout the world.

The virus Epstein and Barr discovered appeared to resemble a herpesvirus because of the characteristic budding through the cellular membrane.

They compared the Burkitt lymphoma virus to other known viruses by isolation procedures, and failed to associate it with established herpesviruses. They reported the discovery of a new virus that played a role in malignancies (Epstein et al., 1964). There are now nine human herpesviruses that have been discovered, although not all are associated with cancer. Other viral families were linked to cancer following the discovery of EBV, including papillomaviridae (HPV of the cervix, anus, penis, and vulva), Hepadnaviridae (hepatocellular carcinoma), and polymaviridae (merkel cell polyomavirus).

The human herpesviridae family consists of a core containing linear double-stranded DNA and an icosahedral capsid approximately 125 nm in diameter (Khalili & Jeang, 2009). The herpesvirus family name comes from the Greek word herpein (“to creep”), which refers to the latent stage in the viral lifecycle (Longnecker, Kieff, & Cohen, 2013). Before the viral life cycle begins, transmission of the virus takes place through different bodily fluids, a common theme among herpesviridae. The latent stage is the phase during the viral lifecycle in which the virus produces limited viral gene expression to maintain viral DNA or infected cells. Long-term persistent infections evade the immune system when the virus is in the latent stage. Periodically, latently infected cells will enter the lytic cycle to produce more of the virus, bud through the plasma membrane, and kill the host cell. Viral genes are expressed and produced in the latent stage as well (Figure 1). The enzymes and proteins expressed help replicate viral DNA, and aid in the formation and release of the viral capsid (Longnecker et al., 2013).

Understanding the processes of these proteins is crucial to elucidating the role viruses play in cancer. Although EBV was the first human tumor virus to be discovered, there is no treatment or vaccine for EBV infection and diseases. Viruses such as human papillomavirus (HPV) now have successful vaccinations, but EBV treatment is still under investigation.

Figure 1: Epstein-Barr virus life cycle

Epstein-Barr virus infects B-cells through bodily fluids in the primary infection or by virus released within the body. EBV enters B-cells by fusion with the membrane after endocytosis. Latently infected B-cells do not express lytic viral proteins until they reactivate. Lytic infection causes gene expression of proteins and viral infection to other cells. During life-long infection, the virus will cycle between latent and lytic depending on immune system pressures.

Figure 2: Epstein-Barr virus episome

The circular EBV episome is approximately 172 kilobase-pairs in length. The terminal repeats (TR) connect the episome.

The major gene products of latent infection are presented. Exons coding for EBERs, EBNAs, and LMPs are displayed on the episome map. Internal repeat (IRs) regions of the episome are also represented in the figure.

The Epstein-Barr Virus

The Epstein-Barr virus is categorized as a member of the Herpesviridae family and Gammaherpesviridae subfamily. Gammaherpesviridae are divided into two genera, Lymphocryptoviridae, which comprises the Epstein-Barr virus, and Rhadinoviridae, which contains the human Kaposi’s sarcoma-associated herpesvirus. Each shares a similar genomic structure, approximately 172 kilobase-pairs in length, and a large central region designed for coding (Longnecker & Neipel, 2007). The viral DNA of EBV consists of a linear, double-stranded molecule. The EBV genome contains terminal repeats located at the end of each linear sequence. These terminal repeats are important to establish infection because they join together to produce the episome (Figure 2). The circular EBV episome contains the open reading frame for coding RNA transcripts and proteins during the lytic cycle (Longnecker, 2013).

The viral DNA of EBV is located in an icosahedral capsid.Globular proteins surround the DNA genome between the capsid and the viral envelope (Longnecker et al., 2013). A glycoprotein called gp350/220 is expressed on the outer envelope, allowing the virus to bind to CD21 (also known as CR2), which is a complement receptor on B-lymphocytes used to enhance antigen responses (Nemerow et al., 1987). The binding is necessary to induce signal transduction pathways that signal viral entry. Viral entry occurs in B-cells as well as epithelial cells. In both cell types, the viral DNA is transported to the nucleus to establish infection. Transformation of B-cells involves expression of viral genes that immortalize B-lymphocytes. After primary infection, the virus will remain in most individuals for the remainder of their lives (Longnecker & Neipel, 2007).

Two variant strains of EBV have been found in humans, EBV1 and EBV2 (Longnecker et al., 2013). The two strains are very similar, but EBV2 is more common in Africa (Zimber et al., 1986). The main difference between EBV1 and EBV2 are the genes encoding the nuclear antigen proteins (Kang & Kieff, 2015).

Epstein-Barr Virus Associated Diseases and Cancers

Epstein-Barr virus has been linked to multiple diseases and cancers. About half the people infected will develop symptoms of varying severity resembling infectious mononucleosis. It is estimated that EBV causes over 200,000 cancers worldwide each year (Longnecker et al., 2013). The most predominant malignancies are Burkitt’s lymphoma and other B-cell lymphomas, nasopharyngeal carcinoma, and gastric cancers.

Infectious Mononucleosis

Epstein-Barr virus infects over 90% of adults worldwide and can cause infectious mononucleosis, the primary disease associated with EBV. Infection with EBV early in life is usually asymptomatic.

In comparison, infection during adolescence or as a young adult results in mononucleosis in about 50% of cases. The name infectious mononucleosis is chosen because of the distinctive changes in the size of activated lymphocytes (monocytes). EBV causing infectious mononucleosis has an incubation period of four to six weeks, and is obtained through the transmission by saliva, which is the reason “mono” is known as the “kissing disease.” The symptoms of mononucleosis include fatigue, swelling of the lymphnodes, pharynx, and tonsils, and fever. Most patients infected with infectious mononucleosis usually improve within two to four weeks, though a small proportion will experience fatigue for six months or more (Longnecker et al., 2013).

Various techniques have been adapted to detect EBV infection.

A mononuclear spot test is a form of the heterophile antibody test used to detect EBV infection. A heterophile antibody specific to EBV, EBV immunoglobulin M (IgM) antibody, is used because the IgM antibody is present during the first two to three months of the illness. Antibodies for the Epstein-Barr virus nuclear antigens (EBNAs) can also be useful because they are expressed three to six weeks after illness and remain present for life (Longnecker et al., 2013). Treatment of mononucleosis is merely supportive. Anti-inflammatory drugs are administered if swelling becomes uncomfortable or obstructs airways.

Burkitt’s Lymphoma

Burkitt’s lymphoma (BL) is relatively rare, but accounts for 30- 50% of lymphomas in children in Africa (Harris & Horning, 2006). BL has been identified as an EBV-positive tumor that occurs in equatorial Africa, climates in which malaria is also an endemic (Burkitt, 1958; Epstein et al., 1964). B-cell proliferation associated with malaria is thought to increase EBV potency and increase the risk for BL development (Longnecker et al., 2013). BL results from a translocation of the myc oncogene. The three most common translocations involve a breakpoint in the long arm of chromosome 8 at the 8q24 locus, adjacent to the first coding exon of the myc gene (Allday, 2009). The most frequent translocation (occurring in 80% of Burkitt lymphoma cases) transposes the telomeric region of chromosome 8 and the immunoglobin heavy chain gene on chromosome 14. The remainder involves either the translocation of chromosome 8 and chromosome 2, or chromosome 8 and

chromosome 22 (Klein, 1981).

As a result of the translocation, myc becomes an active oncogene. The effects of the translocation involving the immunoglobin chains in mature B-cells cause the myc gene to constitutively express myc proteins. The levels of the proteins are higher than seen in normal B-cells, which causes tumor proliferation (Allday, 2009). How the myc gene becomes activated after the translocation in relation to EBV infection is still an area of investigation. Changes in myc levels that activate and repress specific sets of direct target genes of myc-transformed tumor cells indicate that myc levels fluctuate when active (Repellin, Tsimbouri, Philbey, & Wilson, 2010). Treatment for BL involves high doses of radiation, chemotherapy, and surgery to remove the tumor if severe enough.

Hodgkin’s Lymphoma

Hodgkin’s lymphoma (HL) results from white blood cells in the lymphatic system growing abnormally large. These giant malignant cells, called Reed-Sternberg cells, form tumor masses in swollen glands. Individuals with a history of infectious mononucleosis have been linked to a greater risk of HL (Longnecker et al., 2013). HL affects a wide range of individuals with various backgrounds as notable cases include: Mario Lemieux (NHL hockey player), Paul Allen (co-founder of Microsoft), and Flip Saunders (NBA head coach). Most EBV-positive Hodgkin’s lymphomas occur later in life when viral infection can cause long-term consequences. EBV latent proteins are present in transformed Reed-Sternberg cells, but the contribution of EBV is still under investigation.

Nasopharyngeal Carcinoma

Nasopharyngeal carcinoma (NPC) is predominately associated with South East Asia (Khalili & Jeang, 2009). NPC affects epithelial cells of the pharynx behind the nasal passages. It is believed that NPC can result from lifestyle factors as well as genetics. South Asian Cantonese cultures, in particular boat people, include large amounts of salted fish in their diet. The fish are pickled and develop high levels of N-nitrosamines, chemicals that are known carcinogens (Longnecker et al., 2013).

While in the latent phase, EBV has been found to produce small amounts of the virus to allow replication in the epithelial cells of the oral cavity that can be passed to the pharynx. Levels of latent membrane protein 1 (LMP1) maintain epithelial cells in an undifferentiated state, while

latent membrane protein 2 (LMP2) promote growth in NPC. The role of EBV in NPC development is still under investigation, but the presence of the Epstein-Barr virus RNAs (EBERs), Epstein-Barr virus nuclear antigen 1 (EBNA1), and latent membrane proteins LMP1 and LMP2s have been detected in NPC (Longnecker et al., 2013). Treatment for NPC involves surgery, chemotherapy, and radiation therapy. EBV latent proteins are being targeted to apply immunotherapeutic strategies (Cao et al., 2014; Khanna, Moss, & Gandhi, 2005).

Gastric Carcinoma

EBV-associated gastric carcinoma (GC) occurs in approximately 10% of all GC’s. Infected stomach cells express EBNA1, EBERs, and LMP2A. GC was first associated with EBV in 1990 when EBER1 was detected using PCR (Iizasa et al., 2012). Epstein-Barr virus nuclear antigen 1 (EBNA1) expression was found to reduce apoptosis in epithelial stomach cells (Dambaugh, Hennessy, Chamnankit, & Kieff, 1984). How EBV infects epithelial cells remains unclear, but once infected, cells are mediated by cell-to-cell contact to shed and release viral particles (Longnecker et al., 2013).

Multiple Sclerosis

The lifetime risk of multiple sclerosis (MS) is increased with a history of infectious mononucleosis or primary infection of EBV. Viral antibodies of EBNA1 were found to increase before the onset of MS (Levin et al., 2011). While EBV DNA has not been found in the brain, Epstein-Barr virus RNAs (EBERs) and LMP1 have been detected in B-cells located in white brain matter. The role of EBV, like many other diseases and cancers, still remains unclear.

Other Diseases

The link between EBV and various other diseases are still under investigation, such as rheumatoid arthritis, chronic lymphocytic leukemia, systemic lupus erythematosus, and AIDS (Longnecker et al., 2013).

Epstein-Barr Virus Latent Gene Products

The genetic template of EBV determines the behavior of the virus and its ability to infect B-lymphocytes and epithelial cells. The viral transcripts expressed provide the fundamental ability to cause disease. EBV exploits normal B-cell maturation pathways to establish latent infection by a series of viral expression designs that modify host behavior. Understanding how the latent gene products act, such interfering with cell growth signaling, is important to comprehending the biology of EBV diseases. A summary of EBV-associated diseases and gene products can be found in Table 1.

 

Table 1: Epstein-Barr virus associated diseases and gene products. EBV associated cancers and diseases with correlating latent genes involved. Latent gene products differ between diseases. EBERs and EBNA1 are present in all diseases. EBNA1 ensures the viral genome replicates correctly in cell division. Latent membrane proteins are thought to vary between diseases, but still play an important role in B- cell transformation and survival.

 

Epstein-Barr Virus RNAs

Epstein-Barr virus RNAs (EBERs) are non-coding RNAs that are abundantly expressed in latently infected cells (Longnecker et al., 2013). The EBERs promote cellular transformation in Burkitt’s lymphoma, causing the cells to become resistant to apoptosis (Iwakiri & Takada, 2010; Takada & Nanbo, 2001). The two small RNA molecules, EBER1 (166 nucleotides) and EBER2 (172 nucleotides) are expressed at different levels (Glickman, Howe, & Steitz, 1987). The EBERs localize to the cell nucleus and have been found to inhibit apoptosis (Takada & Nanbo, 2001).

EBNA1

Epstein-Barr virus nuclear antigen 1 (EBNA1) was the first EBNA discovered, and arguably the most important because it prevents the EBV genome from becoming lost by cell division in latently infected cells (Rowe et al., 1987). The protein binds to chromosomal DNA during mitosis to ensure that copies of replicated viral DNA are shared equally between dividing cells. The transcription of EBNA1 is also essential for transformation of B-cells. Antibodies against EBNA1 were used to first discover EBV association with Burkitt’s lymphoma (Longnecker et al., 2013).

EBNA2

Epstein-Barr virus nuclear antigen 2 (EBNA2) is needed for B-cell transformation, and helps activate the other nuclear antigens and latent membrane products (Dambaugh et al., 1984). EBNA2 has also been found to increase transcription of cellular genes such as CD21 and c-fgr (Longnecker et al., 2013).

EBNA 3A, 3B, and 3C

The Epstein-Barr virus nuclear antigen 3’s (EBNA3’s) play a role in regulating LMP1 and LMP2 transcription (Kashuba et al., 2000). EBNA3A, B, and C have similar roles in B-cell growth, and work together to control RBP-Jκ, which monitors transduction pathways to activate transcription (Longnecker et al., 2013).

Latent Membrane Proteins

LMP1

The viral oncogene LMP1 is required to establish EBV infection and contributes to the nature of most EBV diseases (Ahsan, Kanda, Nagashima, & Takada, 2005). LMP1 is transcribed from two different promoters separated by 600 base pairs, and encoded in B-cells by a 2.8 kb mRNA that interacts with EBNA2 (Longnecker et al., 2013). The half-life of LMP1 is fairly short, but the protein accumulates at high levels to the plasma membrane (Martin & Sugden, 1991). LMP1 is also found in intracellular membranes, but the distribution between the plasma membrane and intracellular membrane remains unknown (Baichwal & Sugden, 1988; Martin & Sugden, 1991).

LMP1 is a membrane protein that induces constant and active signaling to establish latency by acting as a CD40 tumor necrosis factor receptor mimic (Hatzicassiliou et al., 1998; Kilger, Kieser, Baumann, & Hammerschmidt, 1998). LMP1 is constitutively active, while CD40 acts as a ligand-dependent receptor protein found on antigen presenting cells, and interacts with adaptor proteins called tumor necrosis factor receptor-associated factors (TRAFs). Tumor necrosis factors are cytokines that trigger apoptosis and lead processes associated with cell survival. CD40 binds with its trimeric ligand CD40L and forms homo-trimers that drive downstream proteins and kinases such as nuclear factor kappa B (NF-κB), c-Jun N-terminal kinase (JNK), mitogen-activated protein kinases (MAPK), and phosphatidylinositol 3-kinase signaling from TRAF interactions (Adriaenssens et al., 2004; Mitchell & Sugden, 1995). CD40L is thought to move towards lipid rafts to become membrane associated and interact with the TRAFs (Kaykas, Worringer, & Sugden, 2001). LMP1 mimics CD40 by binding TRAFs from two C-terminus activating regions (CTAR1 and CTAR2), located on its carboxyl- terminal tail (Figure 3). The CTARs bind TRAF1, TRAF2, TRAF3, and TRAF5, which are essential in facilitating immune and inflammatory responses (Higuchi, Izumi, & Kieff, 2001; McWhirter et al., 1999; Schneider et al., 2008). The roles of the TRAFs are to couple cell surface receptors with other cellular proteins and kinases, such as NF-κB and JNK, and to activate signaling pathways. LMP1 thus mediates B-cell transformation through signal transduction (Kilger et al., 1998; Rastelli et al., 2008). While it is known that LMP1 affects downstream factors, how these factors are recruited to LMP1’s signaling complex is still a matter of investigation.

 

Figure 3: Latent membrane protein 1 model. Latent membrane protein 1 contains a short N- terminal tail, a six-fold transmembrane domain, and a large C-terminal tail with two C-terminus activating regions (CTAR1 & CTAR2).

 

LMP2A and LMP2B

Latent membrane protein 2 (LMP2) acts as a constitutive mimic of the B-cell receptor. LMP2, consisting of twelve hydrophobic membrane- spanning domains, localizes in the membrane of B-cells (Longnecker et al., 2013). LMP2A is similar to LMP2B, though LMP2B does not contain the domain required for kinase signaling (Miller et al., 1995; Young, Dawson, & Eliopoulos, 2000). LMP2B may downregulate the activity of LMP2A because it lacks the amino terminal receptor. LMP2A and LMP2B are controlled by separate promoters and can be expressed in infected lymphocytes when needed. LMP2A constitutively interacts with the tyrosine kinases src and syk to produce transforming and survival effects in epithelial cells, but is not important in EBV outgrowth (Higuchi et al., 2011).

Latent Membrane Protein 1 Function and Structure.

Latent membrane protein 1 is a 62-kD integral membrane protein expressed in EBV-associated tumors such as Hodgkin’s lymphoma and nasopharyngeal carcinoma (Longnecker et al., 2013). LMP1 constitutively mimics the signaling of B-cell CD40 tumor necrosis factor receptors. CD40 is an oligomeric-raft associated single spanning membrane protein with an extracellular ligand binding domain and a cytoplasmic signaling domain (Figure 4). LMP1 differs dramatically in its structure from CD40 as LMP1 has six membrane spanning domains as opposed to CD40’s one. LMP1 also differs from CD40 in its apparent independence of a ligand for signaling (Longnecker et al., 2013). CD40’s ligand membrane receptor facilitates B-cell interaction with helper T cells, which then bind and activate downstream factors such as NF-κB (Kaykas et al., 2001; Kilger et al., 1998).

LMP1 is 386 amino acids long and has three structural domains: the N-terminus (aa 1-24), the six-polytopic membrane-spanning domains (aa 25-186), and the C-terminus (aa 187-386). LMP1 is believed to consist of a six-fold transmembrane domain across the plasma membrane, but this claim has yet to be confirmed. The amino-terminal and carboxyl-terminal are on the cytoplasmic side of the plasma membrane. The N-terminal is short, but essential to tethering the protein to the cytoplasmic side of the plasma membrane (Longnecker et al., 2013). On the other hand, the C-terminal is long and contains terminal activating regions CTAR1 and CTAR2 (Figures 3 and 4).

The transmembrane domain is believed to play a crucial role in signal facilitation, oligomerization, and lipid raft association (Clausse, et al., 1997; Higuchi et al., 2001). Removal of the first transmembrane domain disrupted CTAR signaling, suggesting proper orientation and anchoring of LMP1 is mandatory for LMP1 functioning (Li & Chang, 2003). The first two transmembrane domains were found as a loop exposed to the extracellular space (Coffin, Geiger, & Martin, 2002; Martin & Sugden, 1991). Experiments have also interchanged the C-termini of LMP1 and CD40 without signal disruption (Floettmann & Rowe, 1997; Hatzivassiliou et al., 1998). LMP1’s ability to modify survival signaling is why it is considered a viral oncogene. LMP1 is therefore an attractive target to design therapeutic treatments against EBV diseases that express LMP1.

Latent Membrane Protein 1 Lipid Rafts and Oligomerization

Lipid Rafts

Plasma membranes create a barrier that separates the material within the cell from the extracellular environment. These membranes do not create an impermeable barrier, however, materials can get in and out of the cell, allowing signals to be relayed between the outside of the cell and the inside. Such signals can interact with proteins bound to the membrane. One way for proteins to become bound to the membrane is by aggregation in lipid rafts (Harder, Scheiffele, Verkade, & Simons, 1998). Lipid rafts are specialized regions in the cell membrane that contain lipids and cholesterol to comparmentalize cellular signaling molecules such as protein receptors (Gajate & Mollinedo, 2015; Lingwood & Simons, 2010). Since the cell membrane is bilayered, the membrane fluidity can be adjusted by associating sphingolipids and cholesterol into the membrane (Lingwood & Simons, 2010). These regions form drifting microdomains in the membrane with specific lipid and protein compositions. Lipid rafts can organize receptor proteins and their downstream molecules that play a role in modulating the cell cycle and programmed cell death (Hryniewicz-Jankowska et al., 2014).

LMP1 constitutive signaling has been linked to its ability to localize in glycosphingolipid-rich lipid rafts (Ardila-Osorio et al., 1999;

Clausse et al., 1997), but the mechanism by which LMP1 localizes in lipid rafts is still a matter of investigation. Studies have indicated that LMP1’s first two transmembrane domains encode a lipid raft targeting signal and information (Coffin et al., 2003). The lipid raft signal is important because the transmembrane domain is believed to be integral for downstream NF-κB signaling (Higuchi et al, 2001; Kaykas, Worringer, & Sugden, 2002; Yasui et al., 2004). Recent results support the notion that raft-associated LMP1 in oligomeric complexes bring the C-terminal of adjacent LMP1 molecules together to allow crosslinking to occur (Wrobel et al., 2013). The first 25 amino acids of LMP1’s N-terminal region were also found to play a role in lipid raft association and the binding of other cellular components (Rothenberger et al., 2001). LMP1’s transmembrane domain raft association is unique in that it can have enhanced Effects when fused together with CD40. If the raft-associated LMP1 N-terminal signaling domain is joined with CD40’s C-terminus, an enhanced affinity for TRAFs is observed (Kaykas et al., 2001).

Disruption of lipid rafts disturbs the association between TRAF2 and TRAF3 with CD40, suggesting that lipid rafts play a critical role in initiation of CD40 signaling (Vidalain et al., 2000). Since LMP1 and CD40 act in similar fashions, lipid raft disruption of LMP1 could possibly alter signaling in tumor development. Membrane rafts serve as a place of aggregation for signaling proteins, therefore, disrupting lipid rafts may provide a way to alter signaling pathways. Understanding LMP1 lipid raft formation could provide insights into the structure assembly mechanisms involved in malignant transformation.

Figure 4: Latent membrane protein 1 versus CD40 signaling. (A) LMP1 a membrane protein that contains a short N-terminus tail, a polytropic six transmembrane domain, and a long C-terminus tail. In comparison, CD40 is a single spanning membrane protein with a cytoplasmic signaling domain. (B) Lipid raft and oligomerization of LMP1 and CD40L. The C-terminal domains contain binding regions to regulate downstream factors such as NF-κB or JNK. These factors affect cell survival, proliferation, differentiation, and in LMP1’s case transformation (Sammond et al., 2011).

 

Oligomerization

The process of oligomerization causes two or more polypeptide chains to form high ordered structures. Proteins can either homo- oligomerize (contain the same monomers) or hetero-oligomerize (contain two or more different monomers) through covalent, electrostatic, and hydrophobic interactions or hydrogen bonds (Goodsell & Olson, 2000; Gotte & Libonati, 2014). Protein oligomerization can occur by naturally forming covalently linked species, from active covalent complexes starting from inactive monomeric precursors, or through free cysteines of two subunits to form intermolecular disulfides (Gotte & Libonati, 2014). Protein oligomerization is often important in functional control and activating physiological pathways.

Receptor oligomerization has been linked to the activation process of tyrosine kinase receptors (Tartaglia & Goeddel, 1991). Structural studies of CD40 and tumor necrosis factor receptor (TNFR) oligomerization have demonstrated that they assemble into homotrimeric structures (Chan et al., 2000). The TNFRs appear to function as a group rather than

as individual receptor, and allow ligand-induced receptor signaling to initiate. The TNFR group is therefore believed to oligomerize and assemble before binding to the lipid raft domains as ligand independent structures (Chan et al., 2000; Clancy et al., 2005).

Oligomerization is thought to increase TRAFs binding affinity, similar to how hemoglobin’s four-subunit structure allows it to increase its affinity towards O2. TNFR’s affinity for receptors has been found to increase from the monomeric form to the trimeric form (Haswell, Glennie, & Al-Shamkhani, 2001; Pullen et al., 1999).

The greatest TNFR bioactivity is thus seen in trimers. In ligand-induced CD40 (CD40L), the trimeric form causes conformational changes in the CD40L complex to increase its affinity for the tumor necrosis receptor associated factors and lipid raft establishment (Kaykas et al., 2001; Pullen et al., 1999). NF-κB activation was found to increase 20-fold when CD40 was trimerized (as opposed to its monomeric form) (Kaykas et al., 2001). Crystal structures of TRAF2 have demonstrated that the trimeric structure contributes to NF-κB signaling (McWhirter et al., 1999).

Due to the fact that LMP1 is constitutively active (unlike CD40, the protein it mimics), understanding the constitutive activation is important for designing strategies to interfere with LMP1 signaling. The oligomerization of LMP1 is believed to be essential for both its incorporation into plasma membrane lipid rafts and the activation of cellular signaling. Oligomerized TRAFs bind to trimerized TNFRs and, by analogy, LMP1 is thought to bind to TRAFs as a constitutive oligomer (McWhirter et al.,1999). LMP1 is presumed to homo-oligomerize with other LMP1 polypeptides and activate as an oligomer (Coffin et al., 2002; Higuchi et al., 2001).

LMP1’s six transmembrane domains are thought to play many roles in the protein’s ability to oligomerize and localize in membrane microdomains. Oligomerization can increase lipid raft affinity and modulate raft components (Harder et al., 1998). LMP1’s transmembrane domains have a high level of intrinsic stability; therefore, each domain can be studied as independent domains in structural analysis (Sammond et al., 2011). LMP1’s transmembrane domains 1 and 2 were determined to contain a lipid raft signal that determines proper orientation for lipid raft association (Coffin

Figure 5: Schematic view of protein oligomerization. (A) A monomer can become a dimer, trimer, dimer of dimers, or any other multimer of various conformations (Gotte & Libonati, 2014). (B) Oligomers can form different conformations. The way these different oligomers undergo conformational rearrangement can vary depending on the specific protein. (C) How LMP1 forms oligomers is still unknown. It may form a dimer of trimers or other dimer/trimer multimers. These oligomers come together to form the CTAR-TRAF binding regions (Wrobel et al., 2013).

 

et al., 2002; Kaykas et al., 2001). Transmembrane 5 has been observed to form a trimeric complex, suggesting the fifth transmembrane is a potential driving force for LMP1 self-association (Sammond et al., 2011). The transmembrane domains are also important in activating C-terminal TRAF binding and NF-κB signaling (Yasui, Luftig, Soni, & Kieff, 2003).

Although evidence suggests LMP1 homo-oligomerizes, the stoichiometry of LMP1 has not been characterized as a dimer, trimer, or other multimer (Figure 5). Evidence suggests LMP1 forms homo-dimers and/or homo-trimers, but the mechanism of LMP1 oligomerization is unknown (Floettmann & Rowe, 1997; Kung & Raab-Traub, 2008; Wrobel et al., 2013). CD40 functions as a trimer, so by convention LMP1 is thought to trimerize (Kaykas et al., 2001, Wrobel et al., 2013). Determining the structure of LMP1 can help elucidate the mechanism by which LMP1 activates the CTAR interactions and downstream NF-κB signaling with TRAFs.

Hypothesis and Aims

Expression of LMP1 is seen in diseases such as Hodgkin’s lymphoma and nasopharyngeal carcinoma. LMP1 is believed to play an important role in malignant transformation. The mechanism driving LMP1’s constitutive activity is poorly understood. The goal of this project is to gain a better understanding of the structural and functional roles of LMP1 in relation to oligomerization and/or lipid raft association. Previous attempts to express LMP1 for the purpose of purification and crystallization have yet to be demonstrated.

Hypothesis 1: Full length LMP1 and shorter mutant versions of LMP1 can be expressed and purified for structural analysis.

Hypothesis 2: LMP1 forms distinct high ordered complexes organized as functional units. These functional units may form dimers, trimers, or other combinations of multimers.

Hypothesis 3: LMP1 homo-oligomerizes to become lipid raft associated via its predicted spanning six transmembrane domain.

Results

The strategy of LMP1 expression is outlined in Figure 6. The overall principle is to express LMP1 (and mutated versions) in large enough quantities to crystallize the protein and determine its structural and functional roles via x-ray diffraction patterns.

Figure 6: Flow diagram of project. The diagram describes the project overview of LMP1 expression. LMP1 was characterized as the protein of interest. Prokaryotic and eukaryotic methods were employed, utilizing E. coli and insect cells respectively. LMP1 was purified. Structural proteomics will be conducted to determine the structure and functional roles of the protein.

Bacterial Expression

Expression of proteins in E. coli is the quickest and cheapest method. The expression of LMP1 in E. coli was examined using RIPL and Rosetta cell lines (BL21 derivatives). Cells were induced with IPTG and harvested after 18 hours. Initial expression of LMP1 was not detected at 37° C and 22° C. In addition, site-directed mutagenesis to replace rare codons with more commonly used codons in E. coli did not yield expression of LMP1. The codon bias chart to determine which codons needed to be exchange is represented in Figure 7. The LMP1 sequence was broken down into eight site-directed mutagenesis blocks. Each recombinant codon-optimized block was successfully verified by sequencing (Figure 8). The optimized sequence was compared with the standard LMP1 array and primers used in the site-directed mutagenesis process. SDS-PAGE analysis with six of the eight corrected mutagenesis sites failed to detect

. The expression system was therefore changed to the insect cell system. However, if weak expression had been detected, the final two corrected mutagenesis sites would have been replaced and cloned into LMP1 DNA.

Baculovirus/Insect Cell Expression

Preliminary experiments indicate that LMP1 protein was expressed from recombinant baculovirus in Sf21 cells. Histidine-tagged LMP1 purification was achieved from fractioned membranes using a metal affinity resin. The SDS-PAGE Western blot analysis of LMP1 indicated correct expression of LMP1. LMP1 fractions analyzed by SDS-PAGE clearly indicate that LMP1 can be purified, as shown in Figure 10. The overall LMP1 recovery decreased over each fractioned step, but large-scale expression should increase the amount of purified protein and allow sufficient amounts for crystallization.

Discussion

This study is still ongoing in an attempt to determine LMP1’s structure and function. Although LMP1 oligomerization and lipid raft association analysis has yet to be conducted, this study is the first of its kind, involving novel expression and purification of full-length LMP1.

LMP1 expression was attempted with E. coli through recombinant techniques and IPTG induction. Rosetta and RIPL strains are designed to enhance the expression of eukaryotic proteins, but LMP1 was found to exhibit poor expression efficiency. This poor expression was thought to result from the Homo sapiens-E. coli codon bias frequency or incorrect protein folding from post-ribosomal translation. Six of the eight codon corrected sections were replaced and cloned into the LMP1 DNA sequence. Each designed site-directed mutagenesis block corrected 6-7 codons. LMP1 expression was investigated after each section (Figure 8). Increased expression should have been detected, but failed expression was continuously observed; thus, subsequent studies switched to eukaryotic expression.

Many eukaryotic proteins do not fold properly in E. coli and form insoluble inclusion bodies. Protein folding in eukaryotic cells is a complex process, and molecular chaperone machinery is often needed to assist with folding (Hartl & Hayer-Hartl, 2002). It is possible to resolubilize proteins from inclusion bodies or improve solubility by expressing the protein at lower temperatures. Due to the fact that we failed to see any LMP1 expression, it was not necessary to continue expression experiments with various temperatures.

The detection of LMP1 from the insect cells demonstrated that the protein could express at high enough levels to be purified and crystallized. Recombinant LMP1 fractionated in membrane fractions, suggesting that it is in a stable form and folded correctly (Figure 10). The next steps in the process include large-scale purification, which will allow us to crystallize LMP1, and expression with mutant versions of LMP1. The mutant LMP1 versions are LMP1-A5 (a modified version of LMP1 containing 5 alanine residues at positions 204-208, which mutate CTAR1 and the TRAF-binding domain from PQQAT to AAAAA), LMP1-1:220 (amino acids 1 to 220, CTAR2 deleted), and LMP1- 1:220A5 (CTAR1 mutated, CTAR2 deleted). X-ray diffraction will be used to understand the structure and function of LMP1 and LMP1 mutants. Such knowledge may be useful in attempting to inhibit cellular pathways that lead to EBV-associated cancers.

Figure 7: Codon bias between E. coli and Homo sapiens. A total of 41 codons were optimized. E. coli is represented in red, while Homo sapiens is displayed in black. In instances where multiple codons existed, the codon most common to E. coli was exchanged. PCR was conducted to perform site- directed mutagenesis.

Figure 8: Site-directed mutagenesis sequencing. Sequencing indicated the GG block was successfully cloned into the pET-19B vector for LMP1 expression. All other mutagenesis blocks provided correct sequencing.

Figure 9: Bacterial western blot. Bacterial expression of full-length LMP1 and LMP1 1:220 failed. The LMP1 DNA contained codon-optimized blocks PR, GG, RR, GR, GRLL, and GP. The cultures were induced with an OD600 reading of 0.637 A. There was no observed difference in expression between the induced and uninduced control.

Figure 10: LMP! Purified. Western blot indicating recombinant LMP1 (~62 kDa) was successfully purified using a poly-histidine tag, which illustrates it fractionated in membrane fractions. Soluble fractions were taken after each purification step and examined by Western blot analysis. The final elution step contained the purified LMP1.

Conclusion and Future Studies

Upon large-scale purification, LMP1 and LMP1 mutants will be crystallized and analyzed by x-ray spectroscopy in order to determine

their structural relationships. LMP1 structural information can be used to determine the oligomerization of LMP1 and give insights into how LMP1 is associated with lipid rafts. Understanding LMP1 complex formation will aid in the discovery of novel therapeutic strategies to block EBV-associated cancer growth through targeting LMP1.

Materials and Methods

Bacterial Expression

Plasmids

The pET-19B vector (Novagen) was used throughout the experiment (Figure 11). pET-19B-LMP1 site-directed mutagenesis was created using PCR primers that were codon optimized for bacterial expression. Each codon-optimized block contained a restriction enzyme site used to verify that each block was correctly cloned into the vector. The LMP1 DNA was digested with the corresponding restriction enzyme, purified (Qiagen PCR Purification Kit), ligated, and transformed into competent SCS 110 E. coli. Double-stranded oligonucleotides encoding each codon-optimized block were obtained from Integrated DNA Technologies.

Original sequence and primers for site-directed mutagenesis

PR Block

PR Original For: 5’-cggccccctcgaggaccccccctctcctcttccctaggccttgctctc-3’ PR-for’:5’-cgTccGccAcgTggCccGccGctctcctcttccctGggccttgctctc-3’ PR Original Rev: 5’-gggtcctcgagggggccgtcgcgggcccggtgggcccctctcaaggtcgtg-3’

PR-rev:5’-CggGccAcgTggCggAcgGcgcgggcccggtgggccGcGctcaaggtcgtg-3”

PmlI restriction enzyme site created

GG Block

GG OrgFor: 5’-gtgactggactggaggagccctccttgtcctctattcctttgctctcatgcttataattataattttga

tcatc-3’

GG-for’: 5’-gtgactggacCggTggCgccctccttgtcctctattcctttgctctcatgcttatCattatCattttga

tcatc-3’

GG OrgRv: 5’-gagggctcctccagtccagtcactcataacgatgtacagccaaaacagtagcgccaagag-3’ GG-rev’: 5’-gagggcGccAccGgtccagtcactcataacgatgtacagccaaaacagCagcgccaagag-3’ AgeI restriction enzyme site created

RR Block

RR OrgFor: 5’-gtccacttggagccctttgtatactcctactgatgatcaccctc-3’ RR-for’: 5’-gtccacttggagcTctttgtatCctcctGctgatgatcaccctc-3’

RR OrgRev: 5’-tatacaaagggctccaagtggacagagaaggtctcttctgaagataaagatgatc-3’ RR-rev’: 5’-GatacaaagAgctccaagtggacagagaaggtcAcGGcGgaagataaagatgatc-3’ SacI restriction enzyme site created

GRLL Block

GRLL OrgFor: 5’- gatctacttattggagatgctctggcgacttggtgccaccatctggcagcttttggccttcttcctag ccttcttcctagacctcatcctgc -3’

GRLL-for’: 5’-gatctacttaCtCgagatgctctggcgTcttggtgccaccatctggcagcttttggccttcttcctGg

ccttcttcctGgacctcatcctgc-3’

GRLL OrgRev: 5’-ccagagcatctccaataagtagatccagatacctaagacaagtaagcacccgaagatgaacagcacaat

tccaaggaacaatgcctg-3’

GRLL-rev’: 5’-ccagagcatctcGaGtaagtagatccagatacctaagacaagtaagcacccgaagatgaacagcacaat

Gccaaggaacaatgcctg-3’

XhoI restriction enzyme site created

LLGR Block

LLGR OrgFor: 5’-ctctattggttgatctcctttggctcctcctgtttctggcgattttaatctggatgtattaccatggac

aacgacacagtgatgaacac-3’

LLGR -for’: 5’-ctctGttggtCgaCctcctttggctcctcctgtttctggcgattttaatctggatgtattaccatggCc

aacgCcacagtgatgaacac-3’

LLGR OrgRev: 5’-caaaggagatcaaccaatagagtccaccagttttgttgtagatagagagcaataatgag-3’ LLGR -rev’:5’-caaaggagGtcGaccaaCagagtccaccagttttgttgCagatagagagcaataatgag-3’

GP Block

GP OrgFor: 5’-ctgctctcaaaacctGggcgcGcctggCggtggtcctgacaatggcccacaggac-3’ GP –for’: 5’-ctgctctcaaaacctGggcgcGcctggCggtggtcctgacaatggcccacaggac-3’

GP OrgRev: 5’-gaccacctccaggtgcgcctaggttttgagagcagagtgggggtccgtcgccggctccactcacgagcaggtggtgtctgccctcgttggagttag-3’

GPL-rev’: 5’-gctCagctgaacCggAccgtgCgggtcgtcatcatcGccaccggaaccag-3’

SacII restriction enzyme site created

Note: Modified sequences are represented by capitalized nucleotides.

Sequencing

The Genomics Core Facility at Northwestern University sequenced and purified pET-19B-LMP1 after each codon-optimized block was complete. A sample sequence of the GG block can be observed in Figure 8.

Cells

SCS 110 competent E. coli were used for transformation onto Luria-Bertani (LB) plates containing 34 mg/mL of chloramphenicol. Plates were incubated overnight at 37° C. Rosetta (Novagen) E. coli cells were used for protein expression in 200 mL of LB containing 34 mg/ml chloramphenicol and 100 mg/mL ampicillin. Cells were grown at 37° C to an OD600 between 0.6-1.0 and induced with 0.4 mM IPTG.

Western Blotting

Cells were harvested once they reached an OD600 between 0.6-1.0 by centrifugation 12,000 x g for 10 minutes. Cell pellets were lysed on ice with radio imunoprecipitation assay buffer (10 mM Tris-HCl, pH 8/0, 140 mM NaCl, 1% Triton X-100, 0.1% sodium dodecyl sulfate (SDS), 1% deoxychloric acid, protease and phosphatase inhibitors (Pierce)). Cell lysates were clarified by centrifugation and quantitated by Bio-Rad DC protein assay system (Bio-Rad). Samples were boiled in SDS-PAGE sample buffer at 95° and separated using SDS-polyacrylamide gel electrophoresis. The gel was then transferred to nitrocellulose membranes (LiCor) for Western blotting analysis. Primary antibodies used to detect LMP1 were a mixture of four rat monoclonal antibodies diluted to 1:500 (Cao 7E10, Cao 8G3, LMP1 IG6, and Cao 7G8; Ascenion GmbH). LMP1 antibodies were detected with RAT800 biotinylated anti-rat immunoglobulin G (heavy plus light) (16-16-12; Kirkegaard & Perry Laboratories, Inc.) followed by reaction with IRDye 680-labeled streptavidin (Li-Cor). Other bound proteins were detected with IRDye-labeled secondary antibodies by scanning with a Li-Cor Odyssey imaging system. Bands were quantitated using the Li-Cor imaging software. For more information about Western blotting techniques, please see Everly et al. (2009).

Baculovirus/Insect Cell Expression

Plasmids

The plasmids involved in the study were BABE HA-LMP1, which is a pBABEpuro-based vector (addgene), and pFastGlu (generously provided by Dr. Jun-yong Choe), a pFastBac (Thermo Fisher Scientific) (Figure 13) baculovirus transfer vector modified with a glucose transporter sequence (used in a previous study), and a thrombin cleavage site to eliminate the polyhistidine-tag after purification. LMP1 DNA was obtained from previously purified BABE HA-LMP1 with a polyhistidine-tag for purification purposes, digested with NdeI and HindIII, and purified using the QIAquick spin purification kit (QIAGEN). The pFastGlu DNA vector was also digested with NdeI and HindIII restriction endonucleases using the same technique. This technique was also used for mutated versions of LMP1 (BABE HA-LMP1A5, BABE HA- 1:220, and BABE HA-1:220A5) and cloned into pFastGlu baculovirus transfer vectors (Figure 14) for future structural studies (Everly, Mainou, & Raab-Traub, 2009).

Competent Cells

Bacterial transformations were performed with DH10Bac (Invitrogen) competent cells on fresh LB agar plates containing 50

μg/mL kanamycin, 7 μg/mL gentamicin, 10 μg/mL tetracycline, 100 μg/mL X-gal, and 40 μg/mL IPTG to select for DH10Bac transformants. Transformations were incubated at 37° C for 16 hours. Blue/white selection was used to confirm the phenotype (Figure 15A). In addition, colony PCR with primers specific to LMP1 were used to confirm the correct phenotype (Figure 15B).

Primers

LMP1-Bam (forward): 5’-gctggatccaccatggaacacgaccttgagagggggccaccgg-3’

L187-3 (reverse): 5’-atcacgagatcgatatggtaatacatccagattaaaatcgccagaaacaggaggagc-3’

Colony PCR verified colonies were then inoculated in a liquid LB culture containing 50 μg/mL kanamycin, 7 μg/mL gentamicin, and 10

μg/mL tetracycline overnight. DH10Bac bacterial cells were harvested, and DNA was purified using the ZR BAC DNA Miniprep Kit (Zymo Research).

Cell Culture, Transfection, Viral Stock

Spodoptera frugiperda SF21 insect cells were maintained in HyClone SFX-Insect Cell Culture Media (GE Healthcare Life Sciences) supplemented with antibiotic/antimycotic mixture and 10% heat- inactivated fetal bovine serum. Serum-free cells were transfected with Cellfectin II reagent (Life Technologies) to produce recombinant baculovirus according to the Bac-to-Bac Baculovirus Expression System. Cells were stored in 28° C for 72 hours. Medium containing virus was collected and centrifuged to remove cellular debris.Concentrated viral stock was then generated following the same protocol.

Protein Purification and Western Blotting

Sf21 cells were grown in suspension culture to a concentration of 2x106 cells/mL. Cells were scaled to 2 L of supplemented HyClone SFX-Insect Cell Culture media, and were infected with full-length LMP1 baculovirus having a multiplicity of infection (MOI) of approximately

0.1 pfu/mL. Samples were taken at time points 24 hours apart until harvest (0hrs, 24hrs, 48hrs, 72hrs, and 96hrs).

Infected cells were harvested 96 hours post-infection, centrifuged at 2000 x g to separate used media from the cells, and stored at -80° C. The cell pellet was then put back into suspension buffer containing 50 mM sodium phosphate (NaPi) (pH 7.5), 5% glycerol, 200 mM NaCl, lysozyme, and protease inhibitor. The suspension was sonicated four times using 10 second intervals.Cellular debris was removed by centrifugation at 10,000 x g for 2 minutes. The membrane fraction was collected by ultracentrifugation at 200,000 x g for one hour. The fraction was solubilized with 0.5% n- dodecyl-β-D-maltopyranoside (DDM) at 4° C for three hours. The solubilized membrane was separated using centrifugation at 12 x g for 10 minutes. Then the supernatant was loaded into a Talon metal affinity resin (Clontech) and washed with buffer containing 50 mM NaCl, 5 mM imiadazole (pH 7.4), 5% glycerol, and 0.05% DDM. Pure protein was collected from the flow-through and eluted with

20mM Tris (pH 7.5) and 0.02% DDM. For more information on this process, please see Iancu et al. (2013).

Protein samples (50 ng/mL) were then boiled in SDS-PAGE buffer at 95° C. The protein was separated using SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes (LiCor) for Western blotting analysis. Bovine serum albumin (BSA) 10% was used to block the membrane from background binding.

Primary antibodies were used to detect LMP1 was a mixture of four rat monoclonal antibodies diluted to 1:500 (Cao 7E10, Cao 8G3, LMP1 IG6, and Cao 7G8; Ascenion GmbH). LMP1 antibodies were detected with RAT800 biotinylated anti-rat immunoglobulin G (heavy plus light) (16-16-12; Kirkegaard & Perry Laboratories, Inc.) followed by reaction with IRDye 680-labeled streptavidin (Li-Cor). Other bound proteins were detected with IRDye-labeled secondary antibodies by scanning with a Li-Cor Odyssey imaging system. Bands were quantitated using the Li-Cor imaging software. For more information about Western blotting techniques, please see Everly et al. (2009).

Figure 11: pET-19b vector. The pET-19b (Novagen) cloning vector was used to insert LMP1. Site-directed mutagenesis with the pET-19b vector allowed codon optimization blocks to be verified by restriction digestion. The vector had ampicillin resistance to E. coli. The arrows indicate the direction of transcription.

Figure 12: Baculovirus overview. Flowchart describing the separate steps throughout the course of the project. Prokaryotic and eukaryotic methods were both attempted to express LMP1. Diagram of the Bac- to-Bac expression system. Recombinant baculovirus was generated using DH10Bac E. coli cells and transfected using Sf21 cells.

Figure 13: pFastBac1 vector. The pFastBac1 (Life Technologies) vector was modified with a glucose transporter used in previous studies. The vector conferred ampicillin, kanamycin, gentamicin, and tetracycline resistance in E. coli. Arrow indicates the direction of transcription.

Figure 14: GluBac-BABE HA-LMP1 vector-insert.

The diagram represents the vector-insert of GluBac-LMP1, GluBac-LMP1A5, GluBac-LMP1 1:220, and GluBac-LMP1 1:220A5. The vector and all inserts were digested with NdeI and HindIII.

Figure 15: 15 DH10Bac colonies. (A) Transformed DH10BacTM (Invitrogen) E. coli colonies blue/white selection to identify colonies containing the recombinant Bacmid. Eight colonies were selected from the plates. (B) Colony PCR with BamLMP1 and L187-3 primers to verify DNA for miniprep. LMP1 #6 was chosen to carry out the next steps involved in the cloning process.

Acknowledgements

I would like to take the opportunity to thank the H.M. Bligh Cancer Research Laboratories at Rosalind Franklin University of Medicine and Science for funding this project. I would also like to thank Dr. David Everly for providing me the opportunity to work within his lab, and for his support and guidance throughout the course of this project. I look forward to apply what I have learned to my future career in science and medicine.

I would also like to give a special thanks to Pooja Talaty and the other Everly lab members who helped and taught me the technical aspects of this project. In addition, I would like to thank Dr. Jun-yong Choe for his contribution of Sf-21 cells and expertise of protein purification techniques.

Finally, I would like to thank my parents and Jenna Brankin for their unconditional love and support.

Note: Eukaryon is published by students at Lake Forest College, who are solely responsible for its content. The views expressed in Eukaryon do not necessarily reflect those of the College. Articles published within Eukaryon should not be cited in bibliographies. Material contained herein should be treated as personal communication and should be cited as such only with the consent of the author.

References

Adriaenssens, E., Mougel, A., Goormachtigh, G., Loing, E., Fafeur, V., Auriault, C., & Coll, J. (2004). A novel dominant-negative mutant form of epstein-barr virus latent membrane protein-1 (LMP1) selectively and differentially impairs LMP1 and TNF signaling pathways. Oncogene, 23(15), 2681-2693.

Allday, M. J. (2009). How does epstein–barr virus (EBV) complement the activation of myc in the pathogenesis of burkitt’s lymphoma?. Seminars In Cancer Biology, 19(6), 366-376.

Ardila-Osorio, H., Clausse, B., Mishal, Z., Wiels, J., Tursz, T., & Busson, P. (1999). Evidence of LMP1–TRAF3 interactions in glycosphingolipid-rich complexes of lymphoblastoid and nasopharyngeal carcinoma cells. International Journal of Cancer, 81, 645-649.

Baichwal, V. R., & Sugden, B. (1988). Transformation of balb 3T3 cells by the BNLF-1 gene of epstein-barr virus. Oncogene, 2(5), 461- 467.

Bertrand, J. (2004). A brief history of virology. Institute of Biomedical Science. Retrieved from https://www.ibms.org/go/nm:history- virology

Burkitt, D. (1958). A sarcoma involving the jaws in african children. British Journal of Surgery, 46, 218-223.

Cao, Y., Yang, L., Jiang, W., Wang, X., Liao, W., Tan, G., Liao,… Sun, L.Q. (2014). Therapeutic evaluation of epstein-barr virus-encoded latent membrane protein-1 targeted DNAzyme for treating of nasopharyngeal carcinomas. Molecular Therapy: The Journal of the American Society of Gene Therapy, 22(2), 371-377.

Chan, F. K., Chun, H. J., Zheng, L., Siegel, R. M., Bui, K. L., & Lenardo, M. J. (2000). A domain in TNF receptors that mediates ligand-independent receptor assembly and signaling. Science, 288(5475), 2351-2354.

Clancy, L., Mruk, K., Archer, K., Woelfel, M., Mongkolsapaya, J., Screaton, G., & … Ka-Ming, F. C. (2005). Preligand assembly domain-mediated ligand- independent association between TRAIL receptor 4 (TR4) and TR2 regulates TRAIL-induced apoptosis. Proceedings Of The National Academy Of Sciences Of The United States Of America, 102(50), 18099-18104.

Clausse, B., Fizazi, K., Walczak, V., Tetaud, C., Wiels, J., Tursz, T., & Busson, P. (1997). High concentration of the EBV latent membrane protein 1 in glycosphingolipid-rich complexes from both epithelial and lymphoid cells. Virology, 228(2), 285-293.

Coffin III, W. F., Geiger, T. R., & Martin, J. M. (2003). Transmembrane domains 1 and 2 of the latent membrane protein 1 of epstein- barr virus contain a lipid raft targeting signal and play a critical role in cytostasis. Journal Of Virology, 77(6), 3749.

Dambaugh, T., Hennessy, K., Chamnankit, L., & Kieff, E. (1984). U2 region of epstein-barr virus DNA may encode epstein-barr nuclear antigen 2. Proceedings Of The National Academy Of Sciences Of The United States Of America, 81(23), 7632- 7636.

Epstein, M. A. (2012). Burkitt lymphoma and the discovery of epstein- barr virus. The British Journal Of Haematology, 156(6), 777-779.

Epstein, M. A., Henle, G., Achong, B.G., & Barr, Y.M. (1964). Morphological and biological studies on a virus in cultured lymphoblasts from burkitt’s lymphoma. The Journal of Expermental Medicine, 121, 761-770.

Everly, D. N., Mainou, B. A., & Raab-Traub, N. (2009). Transcriptional downregulation of p27KIP1 through regulation of E2F function during LMP1-mediated transformation. Journal of Virology, 83(24), 12671- 12679.

Floettmann, J. E., & Rowe, M. (1997). Epstein-barr virus latent membrane protein-1 (LMP1) C-terminus activation region 2 (CTAR2) maps to the far C-terminus and requires oligomerisation for NF-κB activation. Oncogene, 15(15), 1851- 1858.

Gajate, C., & Mollinedo, F. (2015). Lipid rafts and raft-mediated supramolecular entities in the regulation of CD95 death receptor apoptotic signaling. Apoptosis, 20, 584-606.

Glickman, J. N., Howe, J. G., & Steitz, J. A. (1988). Structural analyses of EBER1 and EBER2 ribonucleoprotein particles present in epstein-barr virus-infected cells. Journal of Virology, 62(3), 902–911.

Goodsell, D. S., & Olson, A. J. (2000). Structural symmetry and protein function. Annual Review Of Biophysics & Biomolecular Structure, 29(1), 105-153.

Gotte, G., & Libonati, M. (2014). Protein oligomerization, oligomerization of chemical and biological compounds. In C. Lesieur (Ed.), Oligomerization of Chemical and Biological Compounds (pp. 239-278). Rijeka, Croatia: Intech.

Harder, T., Scheiffele, P., Verkade, P., & Simons, K. (1998). Lipid domain structure of the plasma membrane revealed by patching of membrane components. Journal Of Cell Biology, 141(4), 929.

Hartl, F. U., & Hayer-Hartl, M. (2002). Molecular chaperones in the cytosol: From nascent chain to folded protein. Science, 295(5561), 1852-1858.

Hatzivassiliou, E., Miller, W. E., Raab-Traub, N., Kieff, E., & Mosialos, G. (1998). A fusion of the EBV latent membrane protein-1 (LMP1) transmembrane domains to the CD40 cytoplasmic domain is similar to LMP1 in constitutive activation of epidermal growth factor receptor expression, nuclear factor-κB, and stress-activated protein kinase. The Journal of Immunology, 160(3), 1116-1121.

Higuchi, M., Izumi, K. M., & Kieff, E. (2001). Esptein-barr virus latent- infection membrane proteins are palmitoylated and raft-associated: Protein 1 binds to the cytoskeleton through TNF receptor cytoplasmic factors. Proceedings Of The National Academy Of Sciences Of The United States Of America, 98(8), 4675.

Hryniewicz-Jankowska, A., Augoff, K., Biernatowska, A., Podkalicka, J., & Sikorski, A. F. (2014). Membrane rafts as a novel target in cancer therapy. BBA - Reviews On Cancer, 1845(2), 155-165.

Iancu, C. V., Zamoon, J., Sang Bum, W., Aleshin, A., & Jun-yong, C. (2013). Crystal structure of a glucose/H+ symporter and its mechanism of action. Proceedings Of The National Academy Of Sciences Of The United States Of America, 110(44), 17862- 17867.

Iizasa, H., Nanbo, A., Nishikawa, J., Jinushi, M., & Yoshiyama, H. (2012). Epstein-barr virus (EBV)-associated gastric carcinoma. Viruses, 4(12), 3420–3439.

Iwakiri, D., & Takada, K. (2010). Role of EBERs in the pathogenesis of EBV infection. In G. F. Vande-Woude & G. Klein (Eds.), Advances in Cancer Research (pp. 119-136). Waltham, MA: Elsevier Academic Press.

Kang, M.S., & Kieff, E. (2015). Epstein-barr virus latent genes. Experimental & Molecular Medicine, 47, e131.

Kashuba, E., Kashuba, V., Pokrovskaja, K., Klein, G., & Szekely, L. (2000). Epstein–barr virus encoded nuclear protein EBNA-3 binds XAP-2, a protein associated with hepatitis B virus X antigen. Oncogene, 19(14), 1801-1806.

Kaykas, A., Worringer, K., & Sugden, B. (2001). CD40 and LMP-1 both signal from lipid rafts but LMP-1 assembles a distinct, more efficient signaling complex. EMBO Journal, 20(11), 2641-2654.

Kaykas, A., Worringer, K., & Sugden, B. (2002). LMP-1’s transmembrane domains encode multiple functions required for LMP-1’s efficient signaling. Journal of Virology, 76(22), 11551-11560.

Khalili, K., & Jeang, KT. (2009). Viral oncology: Basic science and clinical applications: Comprehensive look at the latest research, findings and clinical applications of oncogenic viruses. Hobokin, NJ: Wiley-Blackwell.

Khanna, R., Moss, D., & Gandhi, M. (2005). Technology insight: Applications of emerging immunotherapeutic strategies for epstein-barr virus-associated malignancies. Nature Clinical Practice Oncology, 2(3), 138-149.

Kilger, E., Kieser, A., Baumann, M., & Hammerschmidt, W. (1998).

Epstein-barr virus-mediated B-cell proliferation is dependent upon latent membrane protein 1, which simulates an activated CD40 receptor. The EMBO Journal, 17(6), 1700–1709.

Klein, G. (1981). The role of gene dosage and genetic transpositions in carcinogenesis. Nature, 294, 313-218.

Kung, CP., Meckes, D.G., & Raab-Traub, N. (2011). Epstein-barr virusLMP1 activates EGFR, STAT3, and ERK through effects on PKC. Journal of Virology, 85(9), 4399-4408.

Levin, L. I., Munger, K. L., O’Reilly, E. J., Falk, K. I., & Ascherio, A. (2010). Primary infection with the epstein-barr virus and risk of multiple sclerosis. Annals Of Neurology, 67(6), 824-830.

Li, H.P., & Chang, Y.S. (2003). Epstein-barr virus latent membrane protein 1: Structure and functions. Journal Of Biomedical Science, 10(5), 490-504.

Lingwood, D., & Simons, K. (2010). Lipid rafts as a membrane- organizing principle. Science, 327(5961), 46-50.

Longnecker, R., & Neipel, F. (2007). Introduction to the human γ- herpesviruses. In A. Arvin, G. Campadelli-Fiume, E. Mocarski, et al. (Eds.), Human Herpesviruses: Biology, Therapy, and Immunoprophylaxis. Cambridge, England: Cambridge University Press.

Longnecker, R. M., Kieff, E., & Cohen, J. I. (2013). Epstein-barr virus.In D. M. Knipe & P. M. H Howley (Eds.), Fields Virology (pp. 1898-1958). Philadelphia, PA: Lippincott Williams & Wilkins.

Martin, J., & Sugden, B. (1991) Transformation by the oncogenic latent membrane protein correlates with its rapid turnover, membrane localization, and cytoskeletal association. Journal of Virology, 65, 3246-3258.

McWhirter, S. M., Pullen, S. S., Holton, J. M., Crute, J. J., Kehry, M. R., & Alber, T. (1999). Crystallographic analysis of CD40 recognition and signaling by human TRAF2. Proceedings Of The National Academy Of Sciences Of The United States Of America, 96(15), 8408-8413.

Miller, C. L., Burkhardt, A. L., Lee, J. H., Stealey, B., Longnecker, R., Bolen, J. B., & Kieff, E. (1995). Integral membrane protein 2 of epstein-barr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases.

Immunity, 2, 155-166.

Mitchell, T., & Sugden, B. (1995). Stimulation of NF-kappa B-mediated transcription by mutant derivatives of the latent membrane protein of epstein-barr virus. Journal of Virology, 69(5), 2968-2976.

Mollinedo, F., & Gajate, C. (2015). Lipid rafts as major platforms for signaling regulation in cancer. Advances In Biological Regulation, 57, 130-146.

Nemerow, G. R., Mold, C., Schwend, V. K., Tollefson, V., & Cooper, N.

R. (1987). Identification of gp350 as the viral glycoprotein mediating attachment of epstein-barr virus (EBV) to the EBV/C3d receptor of B cells: Sequence homology of gp350 and C3 complement fragment C3d. Journal of Virology, 61(5), 1416– 1420.

Pullen, S. S., Labadia, M. E., Ingraham, R. H., McWhirter, S. M., Everdeen, D. S., Alber, T., … Kehry, M. R. (1999).

High-affinity interactions of tumor necrosis factor receptor- associated factors (TRAFs) and CD40. Biochemistry, 38(31), 10168-10177.

Rastelli, J., Homig-Holzel, C., Seagal, J., Muller, W., Hermann, A. C., Rajewsky, K., & Zimber-Strobl, U. (2008). LMP1 signaling can replace CD40 signaling in B cells in vivo and has unique features of inducing class-switch recombination to IgG1. Blood, 111(3), 1448-1455.

Repellin, C. E., Tsimbouri, P. M., Philbey, A. W., & Wilson, J. B. (2010).

Lymphoid hyperplasia and lymphoma in transgenic mice expressing the small non-coding RNA, EBER1 of epstein-barr virus. Plos ONE, 5(2), 1-12.

Rothenberger, S., Rausseaux, M., Knecht, H., Bender, F.C., Legler, D.F., & Bron, C. (2002). Association of the epstein-barr virus latent membrane protein 1 with lipid rafts is mediated through its N-terminal region. Cellular and Molecular Life Sciences, 59, 171-180.

Rowe, M., Rowe, D. T., Gregory, C. D., Young, L. S., Farrell, P. J., Rupani, H., & Rickinson, A. B. (1987). Differences in B cell growth phenotype reflect novel patterns of epstein-barr virus latent gene expression in burkitt’s lymphoma cells. The EMBO Journal, 6(9), 2743–2751.

Sammond DW, Joce C, Takeshita R, McQuate SE, Ghosh N, Martin JM, & Yin H. (2011). Transmembrane peptides used to investigate the homo-oligomeric interface and binding hotspot of latent membrane protein 1. Biopolymers, 95(11), 772-84.

Schneider, F., Neugebauer, J., Griese, J., Liefold, N., Kutz, H., Briseno, C., & Kieser, A. (2008) The viral oncoprotein LMP1 exploits TRADD for signaling by masking its apoptotic activity. PLOS Biology, 6(1), 86-98.

Takada, K., & Nanbo, A. (2001). The role of EBERs in oncogenesis. Seminars in Cancer Biology, 11(6), 461-467.

Tartaglia, L. A., & Goeddell, D. V. (1992). Tumor necrosis factor receptor signaling.

A dominant negative mutation suppresses the activation of the 55-kDa tumor necrosis factor receptor. Journal of Biological Chemistry, 267(7), 4304-4307.

Vidalain, P., Azocar, O., Servet-Delprat, C., Rabourdin-Combe, C., Gerlier, D., & Manié, S. (2000). CD40 signaling in human dendritic cells is initiated within membrane rafts. EMBO Journal, 19(13), 3304-3313.

Wrobel, C. M., Geiger, T. R., Nix, R. N., Robitaille, A. M., Weigand, S., Cervantes, A., & … Martin, J. M. (2013). High molecular weight complex analysis of epstein–barr virus latent membrane protein 1 (LMP-1): Structural insights into LMP-1’s homo-oligomerization and lipid raft association. Virus Research, 178(2), 314-327.

Yasui, T., Luftig, M., Soni, V., & Kieff, E. (2004). Latent infection membrane protein transmembrane FWLY is critical for intermolecular interaction, raft localization, and signaling. Proceedings Of The National Academy Of Sciences Of The United States Of America, 101(1), 278-283.

Young, L. S., Dawson, C. W., & Eliopoulos, A. G. (2000). The expression and function of epstein-barr virus encoded latent genes. Molecular Pathology, 53(5), 238–247.

Zimber, U., Adldinger, H. K., Lenoir, G. M., Vuillaume, M., Knebel- Doeberitz, M. V., Laux, G., Desgranges, C.,… Schneider, U. (1986). Geographical prevalence of two types of epstein-barr virus. Virology, 154(1), 56-66.

Related Links: